Anatomy and Physiology Questions
The best high school and college tutors are just a click away, 24×7! Pick a subject, ask a question, and get a detailed, handwritten solution personalized for you in minutes. We cover Math, Physics, Chemistry & Biology.

Anatomy and Physiology
Introduction to PhysiologyWater is an important molecule because it O is a poor solvent since few things dissolve in it O can form hydrogen bonds O has a low heat capacity O is non polar

Anatomy and Physiology
InfexPart A When an acid is added to a solution containing a weak base the weak base will buffer the drop in pH by completely dissociating and accepting all of the hydrogen ions released from the acid O True O False

Anatomy and Physiology
Introduction to PhysiologyThe pH scale O is based on the concentration of hydrogen ions in a solution O is based on the salinity of a solution O is linear O ranges from 1 to 7

Anatomy and Physiology
InfexWhich of the following is NOT one of the three major types of chemical reactio O decomposition Ohyperbolic O synthesis O exchange

Anatomy and Physiology
AbdomenWhich of the following statements regarding atoms is true O Atomic weight is determined by the number of electrons in an atom of a given element O The chemical reactivity of an atom is based on the overall number of electrons in the atom Atomic weight is determined by the number of protons in an atom of a given element O The reactivity of an atom is based on the number of electrons in its outer valance shell

Anatomy and Physiology
InfexRank the chemical bonds from relatively weakest to strongest 1 Ionic II Covalent III Hydrogen O I O I O O

Anatomy and Physiology
BrainWhich of the following statements about the polarity of covalent bonds is correct O Polar covalent bonds involve the transfer of electrons from electropositive atoms to electronegative atoms O The atoms of a polar molecule share electrons equally O Small atoms with 6 or 7 valence shell electrons tend to be electronegative O Nonpolar molecules have partial charges which can lead to hydrogen bonding

Anatomy and Physiology
Introduction to PhysiologyPart A Nonpolar molecules are the result of unequal electron pair sharing O True

Anatomy and Physiology
Introduction to PhysiologyPart A In a solution the solute is the substance present in the greatest amount True O False

Anatomy and Physiology
AbdomenWhich of the following is NOT a difference between a compound and a mixture Some mixtures are homogenous while others are heterogeneous All compounds are homogeneous Mixtures are homogeneous while compounds are heterogeneous No chemical bonding occurs between the components of a mixture The properties of atoms and molecules are not changed when they become part of a mixture Mixtures can be separated by physical means such as straining filtering or evaporation Compounds can only be separated into their constituent atoms by breaking chemical bonds

Anatomy and Physiology
InfexWhich of the following is NOT a subatomic particle O molecule O proton electron neutron

Anatomy and Physiology
Introduction to PhysiologyWhich of the following best describes an isotope a structural variation in which different atoms of the same element have different numbers of neutrons a structural variation in which different atoms of the same element have different numbers of protons O a structural variation in which different atoms of the same element have different numbers of electrons an atom with an unequal number of protons and electrons

Anatomy and Physiology
InfexAtomic weight is equal to the number of protons and neutrons in the nucleus True O False

Anatomy and Physiology
InfexWhat is the difference between kinetic and potential energy O Kinetic energy and potential energy are synonymous they are defined as the capacity to do work actively putting matter into mo O Kinetic energy is stored energy and has the capacity to do work potential energy is expressed through motion O Kinetic energy is energy in action while potential energy is stored energy Kinetic energy may eventually become potential energy but potential energy cannot become kinetic energy

Anatomy and Physiology
Introduction to PhysiologyPrime Minister William Pitt once said Unlimited power is likely to corrupt the minds of those who possess it In other words power often corrupts those in positions of authority How does this theme apply to George Orwell s book Animal Farm Please respond using the RACES formulate Restate the prompt Answer the prompt Cite evidence Explain evidence and then Summarize Each of those five parts of your response is worth 4 points for a total of 20 points possible

Anatomy and Physiology
Introduction to PhysiologyWhat are two signs that Napoleon is not following the Commandment All animals are equal Choose two answers Napoleon and the pigs drink the milk Napoleon works harder than all of the other animals and brags about it Napoleon takes the puppies away from their mothers and secrets them away in order to educate them Napoleon drives Mr Jones off the farm Napoleon looks for ways to improve the farm and the other animals way of life

Anatomy and Physiology
Introduction to PhysiologyProvide some historical context of your self selected topic issue related to infant and toddler care Include an explanation of the significance of the topic in the field of early childhood education and more specifically to those that work directly indirectly with infants and toddlers Section 2 Explanation o This section should explain why you selected this topic and how does it connect with your role in the field early childhood education Section 3 Learning Goals o Based on your selected issue topic draft 3 learning goals you would want viewers of your seminar presentation to walk away with note these are just a quick brainstorm of ideas the learning goals objectives will develop over time as you start conducting research

Anatomy and Physiology
General Anatomy5 Which item below has the least fat Circle one a KFC Original Recipe Bites 6 Piece b Burger King Chicken Apple Cranberry Salad with Grilled Chicker c Arby s Roast Beef Mid Sandwich d Wendy s Ultimate Chicken Grill Sandwich

Anatomy and Physiology
EmbryoWaiter returns and hands each person their drinks You and your friend say thank you in Spanish Waiter asks ready to order in Spanish Use the verb estar You order your food with any specifications I want then order for your guest He She wants Waiter asks Anything else You say that s all thank you Waiter brings food says Enjoy your food customers say thanks Customers comment on food Waiter asks Do y all want dessert Customers respond waiter brings dessert if they order it Use the appropriate phrase taught this year Scene 4 Food Delivery Eating Complete by 1 31 After a while the customer says The check please Image depicts the scene in Book Creator Customers pay say thank you and the waiter saus Thank you Use the appropriate phrase taught this year Waiter is addressing two people Verb querer conjugated properly Any Specifications use con or sin appropriately Use the appropriate phrase taught this year Use the appropriate phrase taught this year Verb estar is conjugated properly Ex My dish name is delicious Verb querer is conjugated properly you all 1 Answer yes and say we want appropriately 2 Answer no we don t want dessert thank you Use the appropriate phrase taught this year

Anatomy and Physiology
InfexBoxer Napoleon Snowball Moses Mr Jones Clover Squealer Old Major Benjamin Mollie Mr Pilkington a horse who continually repeats I will work harder banished by Napoleon banished by Napoleon human owner of Animal Farm before the revolution when it human owner of Animal Farm before the revolution when it A like All men are enemies All animals are comrades old donkey the hardest worker a corrupt opportunist pig who steals puppies from their mothers in order to educate them the propagandist he is the voice of Napoleon Boxer s companion a middle aged mare very maternal white horse who pulls the farmer s cart loves ribbons talks of Sugarcandy Mountain human owner of Animal Farm before the revolution when it was called Manor Farm

Anatomy and Physiology
Introduction to PhysiologyFigure 1 3 AKS Sa3 Which of the following best describes what is occurring in Step 1 of F A Step 1 involves the bacterial plasmid and the gene of interest being cut with enzymes B Step 1 involves the inclusion insertion of the gene of interest within the bac C Step 1 involves both the bacterial plasmid and the gene of interest being cut enzyme D Step 1 involves the inclusion insertion of the bacterial plasmid with the ger 4 AKS 8a3 What is the final result of the process shown in Figure 1 A a DNA mutation B a hybrid C a polyploid D a recombinant DNA 5 AKS 8al Select ALL the advantages of using GMO crops A GMOs allow farmers to grow more crops on less land B GMOs allow farmers to use less pesticide GMOS could lead to new food borne allergies D GMOs often have increased health benefits

Anatomy and Physiology
AbdomenWhy do the animals like Beasts of England so much It is a ballad and a nostalgic story that lets them remember the better times before there were farms It is a song about the superiority of animals over their human counterparts It gives the animals confidence in their ability to fight against any farmer It is a slogan dreamed up by Squealer It is simple and easy to use as a secret code when travelling to other farms in the neighborhood It is a song about freedom and lets them imagine an ideal society after the rebellion It makes them feel strong and united Napoleon told the other animals to like it so they pretend that they do

Anatomy and Physiology
General AnatomyRead the passage from Animal Farm D And the behaviour of the cat was somewhat peculiar It was soon noticed that when there was work to be done the cat could never be found She would vanish for hours on end and then reappear at meal times or in the evening after work was over as though nothing had happened But she always made such excellent excuses and purred so affectionately that it was impossible not to believe in her good intentions What is the central idea of this passage The cat is hungry The cat means well but doesn t know how to behave around the other animals The cat is lazy The cat is ignorant

Anatomy and Physiology
Infexpoints What are two signs that Napoleon is not following the Commandment All animals are equal Choose two answers 00 Napoleon looks for ways to improve the farm and the other animals way of life Napoleon and the pigs drink the milk Napoleon takes the puppies away from their mothers and secrets them away in order to educate them Napoleon works harder than all of the other animals and brags about it Napoleon drives Mr Jones off the farm

Anatomy and Physiology
AbdomenAll of the following are in the original Seven Commandments except No animal shall wear clothes No animal shall sleep in a bed No animal shall drink alcohol All animals are equal None of the above All four of the other answers are part of the Seven Commandmen

Anatomy and Physiology
InfexWhat is Snowball doing when he says Four legs good two legs bad Choose three answers that apply Simplifying the Seven Commandments to make Animalism easier for the animals to understand Creating a simple slogan that can be chanted by the animals Making sure that the humans on the neighboring farms don t try to behave like animals when they arrive at the farm to trade good Distilling Snowball s hatred for humans and helping to stir up similar feelings in others Teaching math to the sheep as part of Snowball s important educational initiatives

Anatomy and Physiology
AbdomenRead the excerpt from Animal Farm E The windmill was in fact Napoleon s own creation Why then asked somebody had he spoken so strongly against it Here Squealer looked very sly That he said was Comrade Napoleon s cunning He had seemed to oppose the windmill simply as a maneuver to get rid of Snowball who was a dangerous character and a bad influence Now that Snowball was out of the way the plan could go forward without his interference This said Squealer was something called tactics He repeated a number of times Tactics comrades tactics The animals were not certain what the word meant but Squealer spoke so persuasively and the three dogs who happened to be with him growled so threateningly that they accepted his explanation without further questions When Squealer explains to the other animals that Napoleon was never opposed to the windmill how does this conflict propel the plot forward O O O O O The other animals realize that Squealer and Napoleon are friends None of the above The other animals realize that Napoleon can be trusted It changes the way the other animals feel about Napoleon It changes the way the other animals feel about the dogs

Anatomy and Physiology
InfexIn what way is George Orwell s Animal Farm an allegory It is a story in which animals act the opposite of how one would expect It is a piece of literature that uses humor to show human weaknesses It is a story in which the characters and events symbolize human truths It is a piece of literature that takes place in a magical imaginary world

Anatomy and Physiology
Abdomen1 List and define Piaget s and NeoPiagetian Stages of Development 2 Essay List and Briefly Define Maslow s Motives Hierarchy and in a Motives Game State Where 3 people fit into the hierarchy

Anatomy and Physiology
InfexWhat is significant about the way the animals arrange themselves during their meeting to hear Old Major speak They are in order of importance The pigs and dogs sit up front with the other animals gathered behind them All of the animals are sitting together in one large gathering to signify that they are truly equal They gather to sit in a circle in order to demonstrate that they are all equal The pigs sit on stage with Old Major and the dogs stand guard at the doors so no animal may leave the barn None of the above The way the sit is completely random

Anatomy and Physiology
Introduction to PhysiologyProduction Possibilities Table This is a model called a production possibilities table To use it correctly we must establish specific rules We will reduce the whole economy to just two commodities potatoes and tractors We will have the economy using the best known technology and utilize the available resources to the fullest in the production of potatoes and tractors Look over the table notice the various combinations then answer the questions Combinations D Potatoes millions of pounds Tractors in thousands A 54 0 B 52 1 C 49 45 2 3 E 40 4 1 At combination B what is the production of potatoes 2 At combination E what is the production of potatoes F 34 5 G 27 6 H 19 7 tractors tractors 3 What happens to the quantity of potatoes as tractor production increases I 10 8 J O 9 4 As the economy moves from producing tractors at combination B to producing tractors at This is the combination C how much change takes place in potato production opportunity cost or the amount of potatoes that must be sacrificed to produce one 1 more unit of tractors cost sacrifice 5 As tractor production moves from combination C to combination D how much change in potato production takes place 6 Increasing tractor production from combination D to combination E changes potato production by what amount 7 If the amount of potato production given up is called cost as the economy moves to increase tractor he made as tractor production moves from B to C from

Anatomy and Physiology
General AnatomyA coniferous evergreen forest is also known as a Tundra Deciduous mixed forest O Tropical rain forest

Anatomy and Physiology
AbdomenThe part of the United States which is predominately Baptist is The Northeast The Southwest The Deep South The Upper Midwest

Anatomy and Physiology
General Anatomymight still describe a valid perspective on scien and its institutions

Anatomy and Physiology
AbdomenGenocide is an inchoate offense This means that O I must be successful in my attempt to commit genocide in order to be prosecuted for genocide None of these answers is correct OI I only have to attempt a genocide to be prosecuted for genocide even if my attempt is a total failure I must kill at least 20 000 people to be tried for genocide

Anatomy and Physiology
General AnatomyWhich of the following is true about the prosecution of genocide perpetrators Perpetrators of the genocide of political groups have been prosecuted by the ICC The Nazi defendants at Nuremberg were tried for the perpetration of genocide against the Jews and Roma The first person convicted of genocide was one of the perpetrators of the Rwanda genocide The Genocide Convention does not ensure for the due process rights of defendants

Anatomy and Physiology
AbdomenAccording to Article 7 of the Rome Statute which of the following acts is considered a crime against humanity all of these answers are correct persecution rape torture

Anatomy and Physiology
AbdomenWhich of the following is true about the crime of genocide under international law Persons accused of genocide may not be granted political asylum by another country The intent requirement for genocide is the same as for crimes against humanity Under universal jurisdiction persons accused of genocide may be tried by any domestic court regardless of whether the genocide took place in the country where that court is located There is a statute of limitations on the crime of genocide meaning that perps can only be tried for a limited amount of time

Anatomy and Physiology
AbdomenGenocide is a jus cogens offense this means that it is an offense against all of humankind Oonly military leaders can be tried for genocide O it is an offense against a country only All of these answers are correct

Anatomy and Physiology
AbdomenAccording to the Genocide Convention if a state has a question over the interpretation applicability or fulfillment of the Convention the appropriate court to hear respond to the question is the International Court of Justice none of these answers is correct

Anatomy and Physiology
AbdomenArticle 8 of the Rome Statute applies to Onone of these answers is correct crimes committed during wartime crimes against humanity committed during peacetime

Anatomy and Physiology
AbdomenArticle 8 of the Genocide Convention makes it possible for countries to grant political asylum to genocide perpetrators individual countries to invade a country to stop it from committing genocide individual countries to sue other countries to stop a genocide countries to call on the organs of the UN to help stop a genocide

Anatomy and Physiology
AbdomenAccording to Article 2 of the UN Genocide Convention genocide is an act committed against racial religious cultural and ethnic groups genocide is an act intended to only partially destroy a group none of these answers is correct genocide is an act perpetrated by state leaders

Anatomy and Physiology
InfexFor this discussion activity you will list five words that are derived from a co cultural group in the United States Then using the words you have listed discuss according to the following questions Why do words change How do these word changes affect interpersonal communication Edit View Insert Format Tools Table

Anatomy and Physiology
General AnatomyEnter the restaurant the waiter or hostess greets you in Spanish You greet them back and say how many people you need a table for Waiter walks you and your guest to the table You ask for the menu Waiter says Here are the menus and gives them to customers Waiter says What do you all want to drink Use the verb Querer TO DRINK PARA BEBER You order your drink and your guest s drink Use the verb querer and say with without ice Greeting matches chosen meal Breakfast Good Morning Lunch Dinner Good afternoon A table for 2 please Written in Spanish with proper grammar Image shows this happening in Book Creator Scene 2 Drink Order complete by 1 30 Use the appropriate phrase taught this year Use the appropriate phrase taught this year Use the appropriate phrase taught this year The verb querer is conjugated appropriately when asking for your drink for your guest s drink I want He she Wants

Anatomy and Physiology
General AnatomyThese are the minimum requirements You may add more if you stay within the parameters of what we learned in class Restaurant choice Choices My guest is What will I drink What will my guest drink Entree that I will eat choose one male or female Entree that my guest will eat Are we eating breakfast or lunch dinner

Anatomy and Physiology
EndocrinologyColumn I 1 LFTS 2 abdominal CT 3 cholangiography 4 stool culture 5 GI endoscopy 6 hemoccult test 7 barium tests 8 abdominal MRI 9 anastomosis 10 laparoscopic surgery Column II its description in Column A X ray examination of bile ducts B Minimally invasive surgery of the abdomen C Visual examination of the gastrointestinal tract colonoscopy D Feces are placed in a growth medium and tested for microorganisms E Cholecystojejunostomy F Magnetic waves create images of abdominal organs in three planes of the body G Measurements of liver enzymes ALT AST alk phos and other substances H Feces are tested for blood stool guaiac test I Series of cross sectional x ray images show abdominal organs 231 J X ray images of the GI tract obtained after introduction of a radiopaque liquid into the rectum or mouth

Anatomy and Physiology
Circulation1 aorta 2 lung capillaries 3 arteries 4 arterioles 5 venules 6 veins 7 pulmonary circulation 8 systemic circulation 9 tissue capillaries 10 heart Column II A Blood vessels that carry bio d to the heart from the body tissues B Largest artery in the body C Tiny blood vessels that lie near cells and through whose walls gases food and wastes can pass D Small veins E Small arteries F Blood vessels that carry blood away from the heart G Passage of blood from the heart to the body tissues and back H Hollow muscular organ that pumps blood all over the body I Tiny blood vessels surrounding lung tissu through which gases pass into and out of the blood J Passage of blood from the heart to the lungs and back to the heart

Anatomy and Physiology
General AnatomyGiven the following gene structures and sequences assuming this gene encodes an enzyme and there are no introns which allele is likely to be dominant Mutations are shown in red Explain 3 marks Promoter Wild type sequence Allele 1 Allele 2 5 CG TATA 3 GC ATAT 5 CG 3 Transcription start site TATG ATTA3 ATAC TAAT5 TATG ATTA3 ATAC TAAT5

Anatomy and Physiology
Introduction to PhysiologyConsider the following DNA molecule Assume this is the DNA sequence of an entire chromosomes After replication what will be the sequence of its sister chromatid Explain the reasoning for your answer 4 marks 5 ATATGTACGGTCTTATTTACCCATACCTATT 3 5 3 TATCATGCCAGAATAAATGGGTATGGATAA