Question:

You are amplifying the region below What is the primer

Last updated: 4/1/2023

You are amplifying the region below What is the primer sequence that would be used to make a copy using the top strand as a template Note pretend primers are only 6 nucleotides long here normally they are 20 nucleotides long also normally you would need a primer to copy the bottom strand template as well but you are not asked for the sequence O 5 AATGAT3 5 GTTACT3 5 CAATGATTCATGGCATTGCATCGAT3 3 GTTACTAAGTACCGTAACGTAGCTA5 O 3 GTTACT5 FAISCAT