Question:

An undergraduate student obtained the DNA sequence shown

Last updated: 1/30/2023

An undergraduate student obtained the DNA sequence shown below as part of a work study project in a lab Based on this DNA sequence how many ORFs does it possibly encode Explain your reasoning Write down the predicted protein sequence s 3 marks 3 5 ATATGTACGGTCATATTTACCCATAACTATT TATCATGCCAGTATAAATGGGTATTGATAA 5 3