Question:

Skin cancer (Basal Cell Carcinoma) is caused by UV light

Last updated: 7/8/2022

Skin cancer (Basal Cell Carcinoma) is caused by UV light striking the skin cells. The light can cause a mutation in the DNA of the basal cells. This mutation can happen in the gene called p53 which is a tumor suppressor gene. Normal DNA: TCAAGG CCCGAGAAATTGACCCATCCAGGTTT Mutated DNA: TCAAGG CCCGAG AAATGA CCC ATCCAG GTT a. What type of mutation was caused by the UV light? Please put an asterick above the mutated DNA where the mutation occurred b. What are 3 symptoms of Basal Cell Carcinoma? c. What did the mutation do to the shape of p53?